circad | circRNAs associated with diseases

circRNA_103781
Gene	n/a	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Gastric Cancer	ICD-10	Stomach, Malignant neoplasm of unspecified (C16.9)
DBLink	Link to database	PMID	28206972
Experimental Method
Sample Type	Tissues	Comparison	125 patients diagnosed with stage III gastric cancer tissue vs adjacent tissues
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward AGCAACCTCATCACCTGGAAC Reverse TGTCTCTTCCTCCAGATTTTCACT	Statistics	Fold Change : Downregulated,3.7102396 pvalue : p=0.012408294
Citation
Zhang, Y, Li, J, Yu, J, Liu, H, Shen, Z, Ye, G, Mou, T, Qi, X, Li, G (2017). Circular RNAs signature predicts the early recurrence of stage III gastric cancer after radical surgery. Oncotarget, 8, 14:22936-22943.